../../tmp/servers/virsirnadb/788066036
Result for your query siRNA sequence
RED | =100 % Complementary sequence |
. | =Identical residue |
blue alphabets | =mismatch |
_ | =Gap |
Acc number | Strain name | Start | Alignment | End | % Identity |
Query | virsi1173 | 1 | ccgggaggtctcgtagaccgtgcatca | 27 | |
D10988.1 | HPCJ8G Hepatitis C virus genome | 316 | ........................... | 342 | 100 |
D90208.1 | HPCJCG Hepatitis C virus ORF gene, complete cds | 304 | ........................... | 330 | 100 |
D90208.1 | HPCJCG Hepatitis C virus ORF gene, complete cds | 3234 | ...ca...........g..________ | 3216 | 59 |
D30613.1 | HPCPP Hepatitis C virus complete genome sequence | 316 | ........................... | 342 | 100 |
D30613.1 | HPCPP Hepatitis C virus complete genome sequence | 3246 | ...ca...........g..________ | 3228 | 59 |
D63822.1 | HPCJK046E2 Hepatitis C virus (isolate JK046) genomic RNA, complete gen | 313 | ........................... | 339 | 100 |
D63821.1 | HPCJK049E1 Hepatitis C virus (isolate JK049) genomic RNA, complete gen | 314 | ........................... | 340 | 100 |
D45172.1 | HPCHCPO Hepatitis C virus genomic RNA for HCV polyprotein, complete cd | 316 | ........................... | 342 | 100 |
D45172.1 | HPCHCPO Hepatitis C virus genomic RNA for HCV polyprotein, complete cd | 3246 | ...ca...........g..________ | 3228 | 59 |
D50409.1 | Hepatitis C virus (isolate BEBE1) genomic RNA, complete genome | 315 | ........................... | 341 | 100 |
Y12083.1 | Hepatitis C virus genotype 6a RNA for HCV polyprotein | 258 | ........................... | 284 | 100 |
U89019.1 | HCU89019 Hepatitis C virus subtype 1b, complete genome | 315 | ........................... | 341 | 100 |
D89815.1 | Hepatitis C virus genomic RNA, complete sequence | 316 | ........................... | 342 | 100 |
D89815.1 | Hepatitis C virus genomic RNA, complete sequence | 3246 | ...ca...........g..________ | 3228 | 59 |
AF165045.1 | Hepatitis C virus subtype 1b strain MD1-1, complete genome | 304 | ........................... | 330 | 100 |
AF165046.1 | Hepatitis C virus subtype 1b strain MD1-2, complete genome | 304 | ........................... | 330 | 100 |
AF165049.1 | Hepatitis C virus subtype 1b strain MD3-1, complete genome | 304 | ........................... | 330 | 100 |
AF165050.1 | Hepatitis C virus subtype 1b strain MD3-2, complete genome | 304 | ........................... | 330 | 100 |
AF165053.1 | Hepatitis C virus subtype 1b strain MD5-1, complete genome | 304 | ........................... | 330 | 100 |
AF165054.1 | Hepatitis C virus subtype 1b strain MD5-2, complete genome | 304 | ........................... | 330 | 100 |
AF165062.1 | Hepatitis C virus subtype 1b strain MD9-2, complete genome | 304 | ........................... | 330 | 100 |
AF165062.1 | Hepatitis C virus subtype 1b strain MD9-2, complete genome | 3234 | ...c.........c..g..________ | 3216 | 59 |
AF169003.1 | Hepatitis C virus subtype 2a isolate G2aK1, complete genome | 315 | ........................... | 341 | 100 |
AF169004.1 | Hepatitis C virus subtype 2a isolate G2aK3, complete genome | 315 | ........................... | 341 | 100 |
AF238481.1 | Hepatitis C virus subtype 2a strain MD2a-1, complete genome | 281 | ........................... | 307 | 100 |
AF238484.1 | Hepatitis C virus subtype 2a strain MD2a-5, complete genome | 281 | ........................... | 307 | 100 |
AF238486.1 | Hepatitis C virus subtype 2b strain MD2b-1, complete genome | 279 | ........................... | 305 | 100 |
AF207752.1 | Hepatitis C virus subtype 1b strain MD11, complete genome | 304 | ........................... | 330 | 100 |
AF207752.1 | Hepatitis C virus subtype 1b strain MD11, complete genome | 3234 | ...c............g..________ | 3216 | 62 |
AF207753.1 | Hepatitis C virus subtype 1b strain MD12, complete genome | 304 | ........................... | 330 | 100 |
AF207755.1 | Hepatitis C virus subtype 1b strain MD14, complete genome | 304 | ........................... | 330 | 100 |
AF207757.1 | Hepatitis C virus subtype 1b strain MD16, complete genome | 304 | ........................... | 330 | 100 |
AF207759.1 | Hepatitis C virus subtype 1b strain MD18, complete genome | 304 | ........................... | 330 | 100 |
AF207759.1 | Hepatitis C virus subtype 1b strain MD18, complete genome | 3234 | ...ca...........g..________ | 3216 | 59 |
AF207759.1 | Hepatitis C virus subtype 1b strain MD18, complete genome | 8616 | ...t..a.a........._________ | 8599 | 55 |
AF207762.1 | Hepatitis C virus subtype 1b strain MD21, complete genome | 304 | ........................... | 330 | 100 |
AF207764.1 | Hepatitis C virus subtype 1b strain MD23, complete genome | 304 | ........................... | 330 | 100 |
AF207765.1 | Hepatitis C virus subtype 1b strain MD24, complete genome | 304 | ........................... | 330 | 100 |
AF207770.1 | Hepatitis C virus subtype 1b strain MD29, complete genome | 304 | ........................... | 330 | 100 |
AF207771.1 | Hepatitis C virus subtype 1b strain MD30, complete genome | 304 | ........................... | 330 | 100 |
AF207773.1 | Hepatitis C virus subtype 1b strain MD32, complete genome | 304 | ........................... | 330 | 100 |
AJ278830.1 | Hepatitis C virus genomic RNA for polyprotein gene | 316 | ........................... | 342 | 100 |
AB049088.1 | Hepatitis C virus genomic RNA, complete genome, isolate: HCVT094 | 316 | ........................... | 342 | 100 |
AB049088.1 | Hepatitis C virus genomic RNA, complete genome, isolate: HCVT094 | 3246 | ...ca...........g..________ | 3228 | 59 |
AB049089.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT10 | 285 | ........................... | 311 | 100 |
AB049090.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT14 | 285 | ........................... | 311 | 100 |
AB049090.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT14 | 3210 | _____...........g..________ | 3197 | 48 |
AB049091.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT14 | 234 | ........................... | 260 | 100 |
AB049094.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT16 | 317 | ........................... | 343 | 100 |
AB049095.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT16 | 285 | ........................... | 311 | 100 |
AF333324.1 | Hepatitis C virus type 1b polyprotein mRNA, complete cds | 316 | ........................... | 342 | 100 |
AF333324.1 | Hepatitis C virus type 1b polyprotein mRNA, complete cds | 3246 | ...ca...........g..________ | 3228 | 59 |
AB047644.1 | Hepatitis C virus gene for polyprotein, complete cds, clone:JCH-5 | 315 | ........................... | 341 | 100 |
AY045702.1 | Hepatitis C virus isolate HCR6, complete genome | 318 | ........................... | 344 | 100 |
AY045702.1 | Hepatitis C virus isolate HCR6, complete genome | 3248 | ...c.........c..g..________ | 3230 | 59 |
AY232730.1 | Hepatitis C virus clone MD2b1-1 polyprotein mRNA, complete cds | 279 | ........................... | 305 | 100 |
AY232731.1 | Hepatitis C virus clone MD2b1-2 polyprotein mRNA, complete cds | 279 | ........................... | 305 | 100 |
AY232732.1 | Hepatitis C virus clone MD2b2-1 polyprotein mRNA, complete cds | 279 | ........................... | 305 | 100 |
AY232733.1 | Hepatitis C virus clone MD2b2-2 polyprotein mRNA, complete cds | 279 | ........................... | 305 | 100 |
AY232734.1 | Hepatitis C virus clone MD2b3-1 polyprotein mRNA, complete cds | 279 | ........................... | 305 | 100 |
AY232735.1 | Hepatitis C virus clone MD2b3-2 polyprotein mRNA, complete cds | 279 | ........................... | 305 | 100 |
AY232736.1 | Hepatitis C virus clone MD2b4-1 polyprotein mRNA, complete cds | 279 | ........................... | 305 | 100 |
AY232737.1 | Hepatitis C virus clone MD2b4-2 polyprotein mRNA, complete cds | 279 | ........................... | 305 | 100 |
AY232738.1 | Hepatitis C virus clone MD2b5-1 polyprotein mRNA, complete cds | 279 | ........................... | 305 | 100 |
AY232739.1 | Hepatitis C virus clone MD2b5-2 polyprotein mRNA, complete cds | 279 | ........................... | 305 | 100 |
AY232740.1 | Hepatitis C virus clone MD2b6-1 polyprotein mRNA, complete cds | 279 | ........................... | 305 | 100 |
AY232741.1 | Hepatitis C virus clone MD2b6-2 polyprotein mRNA, complete cds | 279 | ........................... | 305 | 100 |
AY232742.1 | Hepatitis C virus clone MD2b7-1 polyprotein mRNA, complete cds | 279 | ........................... | 305 | 100 |
AY232743.1 | Hepatitis C virus clone MD2b7-2 polyprotein mRNA, complete cds | 279 | ........................... | 305 | 100 |
AY232744.1 | Hepatitis C virus clone MD2b8-1 polyprotein mRNA, complete cds | 279 | ........................... | 305 | 100 |
AY232745.1 | Hepatitis C virus clone MD2b8-2 polyprotein mRNA, complete cds | 279 | ........................... | 305 | 100 |
AY232746.1 | Hepatitis C virus clone MD2b9-1 polyprotein mRNA, complete cds | 279 | ........................... | 305 | 100 |
AY232746.1 | Hepatitis C virus clone MD2b9-1 polyprotein mRNA, complete cds | 3216 | _____.a............c.._____ | 3200 | 55 |
AY232747.1 | Hepatitis C virus clone MD2b9-2 polyprotein mRNA, complete cds | 279 | ........................... | 305 | 100 |
AY232748.1 | Hepatitis C virus clone MD2b10-1 polyprotein mRNA, complete cds | 279 | ........................... | 305 | 100 |
AY232749.1 | Hepatitis C virus clone MD2b10-2 polyprotein mRNA, complete cds | 279 | ........................... | 305 | 100 |
AY587845.1 | Hepatitis C virus strain RF1_2k/1b, N687 polyprotein gene, complete c | 243 | ........................... | 269 | 100 |
AY587845.1 | Hepatitis C virus strain RF1_2k/1b, N687 polyprotein gene, complete c | 3185 | ...ca...........g..________ | 3167 | 59 |
D84263.2 | Hepatitis C virus (isolate VN235) genomic RNA, complete genome | 313 | ........................... | 339 | 100 |
D84265.2 | Hepatitis C virus (isolate VN004) genomic RNA, complete genome | 313 | ........................... | 339 | 100 |
DQ155561.1 | Hepatitis C virus (isolate D54) polyprotein gene, partial cds | 288 | ........................... | 314 | 100 |
DQ314805.1 | Hepatitis C virus subtype 6e isolate GX004, complete genome | 313 | ........................... | 339 | 100 |
DQ314806.1 | Hepatitis C virus subtype 6g isolate HK6554, complete genome | 313 | ........................... | 339 | 100 |
DQ278892.1 | Hepatitis C virus isolate GZ52557, complete genome | 314 | ........................... | 340 | 100 |
DQ480512.1 | Hepatitis C virus subtype 6a strain 6a77, complete genome | 273 | ........................... | 299 | 100 |
DQ480513.1 | Hepatitis C virus subtype 6a strain 6a35, complete genome | 273 | ........................... | 299 | 100 |
DQ480514.1 | Hepatitis C virus subtype 6a strain 6a63, complete genome | 273 | ........................... | 299 | 100 |
DQ480515.1 | Hepatitis C virus subtype 6a strain 6a64, complete genome | 273 | ........................... | 299 | 100 |
DQ480516.1 | Hepatitis C virus subtype 6a strain 6a61, complete genome | 273 | ........................... | 299 | 100 |
DQ480517.1 | Hepatitis C virus subtype 6a strain 6a73, complete genome | 273 | ........................... | 299 | 100 |
DQ480518.1 | Hepatitis C virus subtype 6a strain 6a65, complete genome | 273 | ........................... | 299 | 100 |
DQ480519.1 | Hepatitis C virus subtype 6a strain 6a66, complete genome | 273 | ........................... | 299 | 100 |
DQ480520.1 | Hepatitis C virus subtype 6a strain 6a67, complete genome | 273 | ........................... | 299 | 100 |
DQ480521.1 | Hepatitis C virus subtype 6a strain 6a69, complete genome | 273 | ........................... | 299 | 100 |
DQ480522.1 | Hepatitis C virus subtype 6a strain 6a72, complete genome | 273 | ........................... | 299 | 100 |
DQ480523.1 | Hepatitis C virus subtype 6a strain 6a62, complete genome | 273 | ........................... | 299 | 100 |
DQ835760.1 | Hepatitis C virus subtype 6f isolate C-0044, complete genome | 313 | ........................... | 339 | 100 |
DQ835761.1 | Hepatitis C virus subtype 6j isolate C-0667, complete genome | 313 | ........................... | 339 | 100 |
DQ835762.1 | Hepatitis C virus subtype 6i isolate C-0159, complete genome | 313 | ........................... | 339 | 100 |
DQ835764.1 | Hepatitis C virus subtype 6f isolate C-0046, complete genome | 313 | ........................... | 339 | 100 |
DQ835766.1 | Hepatitis C virus subtype 6m isolate C-0192, complete genome | 313 | ........................... | 339 | 100 |
DQ835769.1 | Hepatitis C virus subtype 6j isolate Th553, complete genome | 313 | ........................... | 339 | 100 |
EF026073.1 | Hepatitis C virus strain RF3 2/5 polyprotein mRNA, partial cds | 293 | ........................... | 319 | 100 |
EF026073.1 | Hepatitis C virus strain RF3 2/5 polyprotein mRNA, partial cds | 2205 | ______...g.a..t.........___ | 2188 | 55 |
AM408911.1 | Hepatitis C virus partial gene for polyprotein, recombinant 2/5, geno | 293 | ........................... | 319 | 100 |
AM408911.1 | Hepatitis C virus partial gene for polyprotein, recombinant 2/5, geno | 2205 | ______...g.a..t.........___ | 2188 | 55 |
EF424626.1 | Hepatitis C virus subtype 6p isolate QC216, complete genome | 314 | ........................... | 340 | 100 |
EF424628.1 | Hepatitis C virus subtype 6l isolate 537796, complete genome | 313 | ........................... | 339 | 100 |
EF424629.1 | Hepatitis C virus subtype 6c isolate Th846, complete genome | 314 | ........................... | 340 | 100 |
EF407470.1 | Hepatitis C virus isolate 4064 polyprotein gene, complete cds | 268 | ........................... | 294 | 100 |
EF407493.1 | Hepatitis C virus isolate 3031 polyprotein gene, complete cds | 271 | ........................... | 297 | 100 |
EU246930.1 | Hepatitis C virus strain D9 polyprotein gene, complete cds | 291 | ........................... | 317 | 100 |
EU246933.1 | Hepatitis C virus strain D33 polyprotein gene, complete cds | 288 | ........................... | 314 | 100 |
EU246935.1 | Hepatitis C virus strain TH24 polyprotein gene, complete cds | 254 | ........................... | 280 | 100 |
EU408326.1 | Hepatitis C virus isolate 537798 polyprotein precursor, gene, complet | 313 | ........................... | 339 | 100 |
AB429050.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: AH1 | 316 | ........................... | 342 | 100 |
EU255950.1 | Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V241/2005, complet | 234 | ........................... | 260 | 100 |
EU255952.1 | Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V247/2005, complet | 237 | ........................... | 263 | 100 |
EU255994.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V103/2005, complet | 226 | ........................... | 252 | 100 |
EU256053.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V440/2001, complet | 243 | ........................... | 269 | 100 |
EU256085.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V305/2003, complet | 264 | ........................... | 290 | 100 |
EU158186.1 | Hepatitis C virus isolate NK46, complete genome | 282 | ........................... | 308 | 100 |
EU857431.1 | Hepatitis C virus subtype 1b isolate Whu, complete genome | 316 | ........................... | 342 | 100 |
EU857431.1 | Hepatitis C virus subtype 1b isolate Whu, complete genome | 3246 | ...ca...........g..________ | 3228 | 59 |
EU798760.1 | Hepatitis C virus subtype 6v isolate KMN-02 polyprotein precursor, ge | 313 | ........................... | 339 | 100 |
EU798761.1 | Hepatitis C virus subtype 6v isolate KM046 polyprotein precursor, gen | 282 | ........................... | 308 | 100 |
EU643834.1 | Hepatitis C virus isolate HCV-6-D140 polyprotein gene, complete cds | 40 | ........................... | 66 | 100 |
EU643835.1 | Hepatitis C virus isolate HCV-6-D177 polyprotein gene, complete cds | 40 | ........................... | 66 | 100 |
EU643836.1 | Hepatitis C virus isolate HCV-6-D370 polyprotein gene, complete cds | 40 | ........................... | 66 | 100 |
AB442219.1 | Hepatitis C virus subtype 1b genomic RNA, complete genome, clone: 1B- | 316 | ........................... | 342 | 100 |
AB442220.1 | Hepatitis C virus subtype 1b genomic RNA, complete genome, clone: KAH | 316 | ........................... | 342 | 100 |
AB442220.1 | Hepatitis C virus subtype 1b genomic RNA, complete genome, clone: KAH | 3245 | _..ca...........g..________ | 3228 | 55 |
FJ025854.1 | Hepatitis C virus strain P026 polyprotein gene, complete cds | 165 | ........................... | 191 | 100 |
FJ025855.1 | Hepatitis C virus strain P212 polyprotein gene, complete cds | 165 | ........................... | 191 | 100 |
FJ025856.1 | Hepatitis C virus strain P245 polyprotein gene, complete cds | 165 | ........................... | 191 | 100 |
FJ435090.1 | Hepatitis C virus isolate KM181 genotype 6v, complete genome | 313 | ........................... | 339 | 100 |
FJ821465.1 | Hepatitis C virus strain M21-2k/1b, complete genome | 290 | ........................... | 316 | 100 |
FJ821465.1 | Hepatitis C virus strain M21-2k/1b, complete genome | 3232 | ...ca...........g..________ | 3214 | 59 |
AB559564.1 | Hepatitis C virus HCV gene for hepatitis C virus polyprotein, complet | 316 | ........................... | 342 | 100 |
HM777359.1 | Hepatitis C virus isolate C1292 genotype 2j, complete genome | 235 | ........................... | 261 | 100 |
HM777359.1 | Hepatitis C virus isolate C1292 genotype 2j, complete genome | 2147 | ______...g.a..t.........___ | 2130 | 55 |
FN666428.2 | Hepatitis C virus gene for polyprotein, genomic RNA, subtype 2q, isol | 288 | ........................... | 314 | 100 |
FN666428.2 | Hepatitis C virus gene for polyprotein, genomic RNA, subtype 2q, isol | 6755 | ____..........tc.g...._____ | 6772 | 55 |
DQ835770.1 | Hepatitis C virus subtype 6i isolate Th602, complete genome | 313 | ........................y.. | 339 | 96 |
DQ988076.1 | Hepatitis C virus isolate Eg7 polyprotein gene, partial cds | 234 | ........................y.. | 260 | 96 |
X61596.1 | Hepatitis C virus core, E1, NS1/E2, NS2, NS3, NS4a, NS4b and NS5 gene | 299 | ........................c.. | 325 | 96 |
D10749.1 | HPCHCJ1 Hepatitis C virus genomic RNA, complete genome, isolate: HC-J1 | 316 | ........................c.. | 342 | 96 |
D13558.1 | HPCJ483 Hepatitis C virus genome, complete sequence | 316 | ........................c.. | 342 | 96 |
D13558.1 | HPCJ483 Hepatitis C virus genome, complete sequence | 3246 | ...ca...........g..________ | 3228 | 59 |
D10750.1 | HPCJ491 Hepatitis C virus genome, complete sequence | 316 | ........................c.. | 342 | 96 |
D10750.1 | HPCJ491 Hepatitis C virus genome, complete sequence | 3246 | ...ca...........g..________ | 3228 | 59 |
D11168.1 | HPCJTA Hepatitis C virus (HCV) complete genome | 316 | ........................c.. | 342 | 96 |
D11168.1 | HPCJTA Hepatitis C virus (HCV) complete genome | 3246 | ...ca...........g..________ | 3228 | 59 |
D11355.1 | HPCJTB Hepatitis C virus genomic RNA, complete genome, strain: JT' | 316 | ........................c.. | 342 | 96 |
D11355.1 | HPCJTB Hepatitis C virus genomic RNA, complete genome, strain: JT' | 3246 | ...ca...........g..________ | 3228 | 59 |
D00944.1 | HPCPOLP Hepatitis C virus genomic RNA for polyprotein, complete cds | 315 | ........................c.. | 341 | 96 |
M96362.1 | HPCUNKCDS Hepatitis C virus mRNA, complete cds | 317 | ........................c.. | 343 | 96 |
M67463.1 | HPCCGAA Hepatitis C virus subtype 1a, complete genome | 316 | ........................c.. | 342 | 96 |
L02836.1 | HPCCGENOM Hepatitis C virus subtype 1b strain HeBei, complete genome | 305 | ........................c.. | 331 | 96 |
M84754.1 | HPCGENANTI Hepatitis C virus subtype 1b strain Taiwan, complete genome | 316 | ........................c.. | 342 | 96 |
M58335.1 | HPCHUMR Hepatitis C virus subtype 1b, complete genome | 307 | ........................c.. | 333 | 96 |
M58335.1 | HPCHUMR Hepatitis C virus subtype 1b, complete genome | 3237 | ...ca...........g..________ | 3219 | 59 |
M62321.1 | HPCPLYPRE Hepatitis C virus subtype 1a, complete genome | 316 | ........................c.. | 342 | 96 |
S62220.1 | Hepatitis C virus subtype 1b, complete genome | 315 | ........................c.. | 341 | 96 |
U01214.1 | HCU01214 Hepatitis C virus subtype 1b strain HCV-L2, complete genome | 317 | ........................c.. | 343 | 96 |
U01214.1 | HCU01214 Hepatitis C virus subtype 1b strain HCV-L2, complete genome | 3247 | ...ca...........g..________ | 3229 | 59 |
D14853.1 | HPCCGS Hepatitis C virus (isolate HC-G9) genomic RNA, complete genome | 316 | ........................c.. | 342 | 96 |
D10934.1 | HPCRNA Hepatitis C virus RNA, complete genome sequence | 316 | ........................c.. | 342 | 96 |
U16362.1 | HCU16362 Hepatitis C virus subtype 1b, complete genome | 317 | ........................c.. | 343 | 96 |
X76918.1 | Hepatitis C virus genes for core, envelope and NS1 proteins | 273 | ........................a.. | 299 | 96 |
D49374.1 | HPCFG Hepatitis C virus (isolate Tr Kj) genomic RNA, complete genome | 314 | ........................a.. | 340 | 96 |
D63857.1 | HPVHCVN Hepatitis C virus gene for E1 and E2/NS1 envelope glycoprotein | 223 | ........................c.. | 249 | 96 |
D63857.1 | HPVHCVN Hepatitis C virus gene for E1 and E2/NS1 envelope glycoprotein | 3153 | ...ca...........g..________ | 3135 | 59 |
D50482.1 | HPCK1R3 Hepatitis C virus (strain HCV-1b, clone HCV-K1-R3), complete g | 304 | ........................c.. | 330 | 96 |
D50483.1 | HPCK1S1 Hepatitis C virus (strain HCV-1b, clone HCV-K1-S1), complete g | 304 | ........................c.. | 330 | 96 |
D50483.1 | HPCK1S1 Hepatitis C virus (strain HCV-1b, clone HCV-K1-S1), complete g | 3234 | ...cc..............________ | 3216 | 62 |
D50484.1 | HPCK1S3 Hepatitis C virus (strain HCV-1b, clone HCV-K1-S3), complete g | 304 | ........................c.. | 330 | 96 |
D50485.1 | HPCK1S2 Hepatitis C virus (strain HCV-1b, clone HCV-K1-S2), complete g | 304 | ........................c.. | 330 | 96 |
D50481.1 | HPCK1R2 Hepatitis C virus (strain HCV-1b, clone HCV-K1-R2), complete g | 304 | ........................c.. | 330 | 96 |
D50480.1 | HPCK1R1 Hepatitis C virus (strain HCV-1b, clone HCV-K1-R1), complete g | 304 | ........................c.. | 330 | 96 |
D50480.1 | HPCK1R1 Hepatitis C virus (strain HCV-1b, clone HCV-K1-R1), complete g | 3234 | ...cc...........g..________ | 3216 | 59 |
D14484.1 | HPCJRNA Hepatitis C virus strain J33 genomic RNA, complete genome | 316 | ........................c.. | 342 | 96 |
D14484.1 | HPCJRNA Hepatitis C virus strain J33 genomic RNA, complete genome | 3246 | ...ca...........g..________ | 3228 | 59 |
U45476.1 | HCU45476 Hepatitis C virus isolate HD-1, complete genome | 316 | ........................c.. | 342 | 96 |
U45476.1 | HCU45476 Hepatitis C virus isolate HD-1, complete genome | 3246 | ...ca...........g..________ | 3228 | 59 |
D85516.1 | Hepatitis C virus genomic RNA, complete cds | 316 | ........................c.. | 342 | 96 |
D85516.1 | Hepatitis C virus genomic RNA, complete cds | 3246 | ...ca...........g..________ | 3228 | 59 |
AF011751.1 | Hepatitis C virus strain H77 pCV-H77C polyprotein gene, complete cds | 316 | ........................c.. | 342 | 96 |
AF011752.1 | Hepatitis C virus strain H77 pCV-H11 polyprotein gene, complete cds | 316 | ........................c.. | 342 | 96 |
AF011753.1 | Hepatitis C virus strain H77 pH21 polyprotein gene, complete cds | 316 | ........................c.. | 342 | 96 |
AJ000009.1 | Hepatitis C virus complete genome sequence | 299 | ........................c.. | 325 | 96 |
AJ000009.1 | Hepatitis C virus complete genome sequence | 3229 | ...c............g..._______ | 3210 | 66 |
AF046866.1 | Hepatitis C virus subtype 3a strain CB polyprotein gene, complete cds | 314 | ........................a.. | 340 | 96 |
AF054247.1 | Hepatitis C virus subtype 1b strain HC-J4 isolate pCV-J4L6S, complete | 316 | ........................c.. | 342 | 96 |
AF054247.1 | Hepatitis C virus subtype 1b strain HC-J4 isolate pCV-J4L6S, complete | 3246 | ...ca...........g..________ | 3228 | 59 |
AF054248.1 | Hepatitis C virus subtype 1b strain HC-J4 isolate pCV-J4L2S, complete | 316 | ........................c.. | 342 | 96 |
AF054248.1 | Hepatitis C virus subtype 1b strain HC-J4 isolate pCV-J4L2S, complete | 3246 | ...ca...........g..________ | 3228 | 59 |
AF054249.1 | Hepatitis C virus subtype 1b strain HC-J4 isolate pCV-J4L4S, complete | 317 | ........................c.. | 343 | 96 |
AF054249.1 | Hepatitis C virus subtype 1b strain HC-J4 isolate pCV-J4L4S, complete | 3247 | ...ca...........g..________ | 3229 | 59 |
AF054250.1 | Hepatitis C virus subtype 1b strain HC-J4, complete genome | 306 | ........................c.. | 332 | 96 |
AF054250.1 | Hepatitis C virus subtype 1b strain HC-J4, complete genome | 3236 | ...ca...........g..________ | 3218 | 59 |
AF064490.1 | Hepatitis C virus (isolate SA13) polyprotein gene, complete cds | 221 | ........................a.. | 247 | 96 |
AJ132996.1 | Hepatitis C virus, complete genome, isolate HCV-AD78 | 315 | ........................c.. | 341 | 96 |
AJ132996.1 | Hepatitis C virus, complete genome, isolate HCV-AD78 | 3251 | ...ca...........g..________ | 3233 | 59 |
AJ132997.1 | Hepatitis C virus, complete genome, isolate HCV-AD78P1 | 315 | ........................c.. | 341 | 96 |
AJ132997.1 | Hepatitis C virus, complete genome, isolate HCV-AD78P1 | 3245 | ...ca...........g..________ | 3227 | 59 |
AJ238799.1 | Hepatitis C virus type 1b complete genome, isolate Con1 | 316 | ........................c.. | 342 | 96 |
AJ238799.1 | Hepatitis C virus type 1b complete genome, isolate Con1 | 3246 | ...ca...........g..________ | 3228 | 59 |
AF176573.1 | Hepatitis C virus subtype 1b strain 274933RU, complete genome | 316 | ........................c.. | 342 | 96 |
AB016785.1 | Hepatitis C virus genomic RNA, complete sequence | 317 | ........................c.. | 343 | 96 |
AB016785.1 | Hepatitis C virus genomic RNA, complete sequence | 3250 | ...ca...........g..________ | 3232 | 59 |
AF165047.1 | Hepatitis C virus subtype 1b strain MD2-1, complete genome | 304 | ........................c.. | 330 | 96 |
AF165048.1 | Hepatitis C virus subtype 1b strain MD2-2, complete genome | 304 | ........................c.. | 330 | 96 |
AF165051.1 | Hepatitis C virus subtype 1b strain MD4-1, complete genome | 304 | ........................c.. | 330 | 96 |
AF165051.1 | Hepatitis C virus subtype 1b strain MD4-1, complete genome | 3234 | ...ca...........g..________ | 3216 | 59 |
AF165052.1 | Hepatitis C virus subtype 1b strain MD4-2, complete genome | 304 | ........................c.. | 330 | 96 |
AF165052.1 | Hepatitis C virus subtype 1b strain MD4-2, complete genome | 3234 | ...ca...........g..________ | 3216 | 59 |
AF165055.1 | Hepatitis C virus subtype 1b strain MD6-1, complete genome | 304 | ........................a.. | 330 | 96 |
AF165056.1 | Hepatitis C virus subtype 1b strain MD6-2, complete genome | 304 | ........................a.. | 330 | 96 |
AF165057.1 | Hepatitis C virus subtype 1b strain MD7-1, complete genome | 304 | ........................c.. | 330 | 96 |
AF165057.1 | Hepatitis C virus subtype 1b strain MD7-1, complete genome | 3234 | ...c............g..________ | 3216 | 62 |
AF165058.1 | Hepatitis C virus subtype 1b strain MD7-2, complete genome | 304 | ........................c.. | 330 | 96 |
AF165058.1 | Hepatitis C virus subtype 1b strain MD7-2, complete genome | 3234 | ...c............g..________ | 3216 | 62 |
AF165059.1 | Hepatitis C virus subtype 1b strain MD8-1, complete genome | 304 | ........................c.. | 330 | 96 |
AF165059.1 | Hepatitis C virus subtype 1b strain MD8-1, complete genome | 3234 | ...ca...........g..________ | 3216 | 59 |
AF165060.1 | Hepatitis C virus subtype 1b strain MD8-2, complete genome | 304 | ........................c.. | 330 | 96 |
AF165061.1 | Hepatitis C virus subtype 1b strain MD9-1, complete genome | 304 | ........................c.. | 330 | 96 |
AF165061.1 | Hepatitis C virus subtype 1b strain MD9-1, complete genome | 3234 | ...c.........c..g..________ | 3216 | 59 |
AF165061.1 | Hepatitis C virus subtype 1b strain MD9-1, complete genome | 1523 | ..t..........cg.g..._______ | 1504 | 59 |
AF165063.1 | Hepatitis C virus subtype 1b strain MD10-1, complete genome | 304 | ........................c.. | 330 | 96 |
AF165064.1 | Hepatitis C virus subtype 1b strain MD10-2, complete genome | 304 | ........................c.. | 330 | 96 |
AB031663.1 | Hepatitis C virus (isolate VAT96) genomic RNA, complete genome | 316 | ........................c.. | 342 | 96 |
AB031663.1 | Hepatitis C virus (isolate VAT96) genomic RNA, complete genome | 6783 | ____..........tc......_____ | 6800 | 59 |
AF169002.1 | Hepatitis C virus subtype 2a isolate NDM228, complete genome | 315 | ........................c.. | 341 | 96 |
AF169005.1 | Hepatitis C virus subtype 2a isolate NDM59, complete genome | 315 | ........................c.. | 341 | 96 |
AF238482.1 | Hepatitis C virus subtype 2a strain MD2a-2, complete genome | 281 | ........................c.. | 307 | 96 |
AF238483.1 | Hepatitis C virus subtype 2a strain MD2a-4, complete genome | 281 | ........................c.. | 307 | 96 |
AF238485.1 | Hepatitis C virus subtype 2a strain MD2a-7, complete genome | 281 | ........................c.. | 307 | 96 |
AF238485.1 | Hepatitis C virus subtype 2a strain MD2a-7, complete genome | 6748 | ____..........tt.....______ | 6764 | 55 |
AF208024.1 | Hepatitis C virus subtype 1b strain MD34, complete genome | 304 | ........................c.. | 330 | 96 |
AF208024.1 | Hepatitis C virus subtype 1b strain MD34, complete genome | 3228 | ...ca...........g._________ | 3211 | 55 |
AF207754.1 | Hepatitis C virus subtype 1b strain MD13, complete genome | 304 | ........................c.. | 330 | 96 |
AF207754.1 | Hepatitis C virus subtype 1b strain MD13, complete genome | 3234 | ...ca...........g..________ | 3216 | 59 |
AF207756.1 | Hepatitis C virus subtype 1b strain MD15, complete genome | 304 | ........................c.. | 330 | 96 |
AF207756.1 | Hepatitis C virus subtype 1b strain MD15, complete genome | 3234 | ...ca...........g..________ | 3216 | 59 |
AF207758.1 | Hepatitis C virus subtype 1b strain MD17, complete genome | 304 | ........................c.. | 330 | 96 |
AF207758.1 | Hepatitis C virus subtype 1b strain MD17, complete genome | 3234 | .t.c............g..________ | 3216 | 59 |
AF207760.1 | Hepatitis C virus subtype 1b strain MD19, complete genome | 304 | ........................c.. | 330 | 96 |
AF207761.1 | Hepatitis C virus subtype 1b strain MD20, complete genome | 304 | ........................c.. | 330 | 96 |
AF207763.1 | Hepatitis C virus subtype 1b strain MD22, complete genome | 304 | ........................c.. | 330 | 96 |
AF207763.1 | Hepatitis C virus subtype 1b strain MD22, complete genome | 3234 | ...ta...........g..________ | 3216 | 59 |
AF207766.1 | Hepatitis C virus subtype 1b strain MD25, complete genome | 304 | ........................c.. | 330 | 96 |
AF207766.1 | Hepatitis C virus subtype 1b strain MD25, complete genome | 3234 | ...c............g..________ | 3216 | 62 |
AF207768.1 | Hepatitis C virus subtype 1b strain MD27, complete genome | 304 | .................t......... | 330 | 96 |
AF207769.1 | Hepatitis C virus subtype 1b strain MD28, complete genome | 304 | ........................c.. | 330 | 96 |
AF207772.1 | Hepatitis C virus subtype 1b strain MD31, complete genome | 304 | ........................c.. | 330 | 96 |
AF207774.1 | Hepatitis C virus subtype 1b strain MD33, complete genome | 304 | ........................c.. | 330 | 96 |
AF207774.1 | Hepatitis C virus subtype 1b strain MD33, complete genome | 3234 | ...ca...........g..________ | 3216 | 59 |
AF271632.1 | Hepatitis C virus subtype 1a clone pHCV-1/SF9 A, complete genome | 316 | ........................c.. | 342 | 96 |
AF290978.1 | Hepatitis C virus subtype 1a isolate colonel, complete genome | 304 | ........................c.. | 330 | 96 |
AB049087.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT05 | 285 | ........................c.. | 311 | 96 |
AB049092.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT14 | 285 | ........................c.. | 311 | 96 |
AB049093.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT15 | 285 | ........................c.. | 311 | 96 |
AB049096.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT19 | 285 | ........................c.. | 311 | 96 |
AB049097.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT19 | 285 | ........................c.. | 311 | 96 |
AB049098.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT20 | 285 | ........................c.. | 311 | 96 |
AB049098.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT20 | 3215 | ...ca...........g..________ | 3197 | 59 |
AB049099.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT21 | 316 | ........................c.. | 342 | 96 |
AB049099.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT21 | 3249 | ...ca...........___________ | 3234 | 51 |
AB049100.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT21 | 285 | ........................c.. | 311 | 96 |
AB049101.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT22 | 285 | ........................c.. | 311 | 96 |
AB049101.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT22 | 3215 | ...ca...........g..________ | 3197 | 59 |
AB047639.1 | Hepatitis C virus (isolate JFH-1) genomic RNA, complete genome | 315 | ........................c.. | 341 | 96 |
AB047640.1 | Hepatitis C virus gene for polyprotein, complete cds, clone:JCH-1 | 315 | ........................c.. | 341 | 96 |
AB047641.1 | Hepatitis C virus gene for polyprotein, complete cds, clone:JCH-2 | 315 | ........................c.. | 341 | 96 |
AB047642.1 | Hepatitis C virus gene for polyprotein, complete cds, clone:JCH-3 | 315 | ........................c.. | 341 | 96 |
AB047645.1 | Hepatitis C virus gene for polyprotein, complete cds, clone:JCH-6 | 315 | ........................c.. | 341 | 96 |
AY051292.1 | Hepatitis C virus (isolate India) polyprotein mRNA, complete cds | 316 | ........................c.. | 342 | 96 |
AF356827.1 | Hepatitis C virus subtype 1b isolate HCV-S1, complete genome | 316 | ........................c.. | 342 | 96 |
AF483269.1 | Hepatitis C virus type 1b isolate HCV-TR1 from Turkey, complete genom | 281 | ........................c.. | 307 | 96 |
AF511948.1 | Hepatitis C virus isolate XF222 polyprotein-like gene, complete seque | 316 | ........................c.. | 342 | 96 |
AF511949.1 | Hepatitis C virus isolate XF223 polyprotein-like gene, complete seque | 316 | ........................c.. | 342 | 96 |
AF511950.1 | Hepatitis C virus isolate XF224 polyprotein-like gene, complete seque | 288 | ........................c.. | 314 | 96 |
AF139594.2 | Hepatitis C virus subtype 1b strain HCV-N, complete genome | 316 | ........................c.. | 342 | 96 |
AB080299.1 | Hepatitis C virus genomic RNA, complete genome, isolate:M1LE | 316 | ........................c.. | 342 | 96 |
AB080299.1 | Hepatitis C virus genomic RNA, complete genome, isolate:M1LE | 3246 | ...ca...........g..________ | 3228 | 59 |
AY460204.1 | Hepatitis C virus from Shanghai, complete genome | 316 | ........................c.. | 342 | 96 |
AY587844.1 | Hepatitis C virus strain N589 polyprotein gene, complete cds | 264 | ........................c.. | 290 | 96 |
AY651061.1 | Hepatitis C virus isolate Khaja1, complete genome | 316 | ........................c.. | 342 | 96 |
AY746460.1 | Hepatitis C virus genotype 2a polyprotein gene, complete cds | 315 | ........................c.. | 341 | 96 |
AB154177.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 304 | ........................c.. | 330 | 96 |
AB154178.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 304 | ........................c.. | 330 | 96 |
AB154179.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 304 | ........................c.. | 330 | 96 |
AB154180.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 304 | ........................c.. | 330 | 96 |
AB154181.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 304 | ........................c.. | 330 | 96 |
AB154181.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 3229 | _____...........g..c.______ | 3214 | 51 |
AB154182.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 304 | ........................c.. | 330 | 96 |
AB154182.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 3229 | _____...........g..c.______ | 3214 | 51 |
AB154183.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 304 | ........................c.. | 330 | 96 |
AB154185.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 304 | ........................c.. | 330 | 96 |
AB154186.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 304 | ........................c.. | 330 | 96 |
AB154187.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 304 | ........................c.. | 330 | 96 |
AB154187.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 3229 | _____...........g..c.______ | 3214 | 51 |
AB154189.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 304 | ........................c.. | 330 | 96 |
AB154189.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 3229 | _____...........g..c.______ | 3214 | 51 |
AB154190.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 304 | ........................c.. | 330 | 96 |
AB154190.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 3229 | _____...........g..c.______ | 3214 | 51 |
AB154191.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 304 | ........................c.. | 330 | 96 |
AB154191.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 3229 | _____...........g..c.______ | 3214 | 51 |
AB154192.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 304 | ........................c.. | 330 | 96 |
AB154192.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 3229 | _____...........g..c.______ | 3214 | 51 |
AB154194.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 304 | ........................c.. | 330 | 96 |
AB154198.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 304 | ........................c.. | 330 | 96 |
AB154198.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 3229 | _____...........g..c.______ | 3214 | 51 |
AB154199.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 304 | ........................c.. | 330 | 96 |
AB154199.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 3229 | _____...........g..c.______ | 3214 | 51 |
AB154200.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 304 | ........................c.. | 330 | 96 |
AB154200.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 3229 | _____...........g..c.______ | 3214 | 51 |
AB154201.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 304 | ........................c.. | 330 | 96 |
AB154201.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 3234 | ...ca...........g..c.______ | 3214 | 62 |
AB154202.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 304 | ........................c.. | 330 | 96 |
AB154202.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 3234 | ...ca...........g..c.______ | 3214 | 62 |
AB154203.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 304 | ........................c.. | 330 | 96 |
AB154203.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 3229 | _____...........g..c.______ | 3214 | 51 |
AB154204.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 304 | ........................c.. | 330 | 96 |
AB154204.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 3229 | _____...........g..c.______ | 3214 | 51 |
AB154205.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 304 | ........................c.. | 330 | 96 |
AB154205.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 3229 | _____...........g..c.______ | 3214 | 51 |
AB154206.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 304 | ........................c.. | 330 | 96 |
AB154206.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 3229 | _____...........g..c.______ | 3214 | 51 |
AY859526.1 | Hepatitis C virus (isolate 6a33), complete genome | 270 | ...................c....... | 296 | 96 |
D84264.2 | Hepatitis C virus (isolate VN405) genomic RNA, complete genome | 313 | ........................a.. | 339 | 96 |
D84264.2 | Hepatitis C virus (isolate VN405) genomic RNA, complete genome | 3244 | _____..........ag....______ | 3229 | 51 |
AB191333.1 | Hepatitis C virus genomic RNA, complete genome, strain:0 | 316 | ........................c.. | 342 | 96 |
AY878650.1 | Hepatitis C virus subtype 6k isolate KM45, complete genome | 299 | ........................c.. | 325 | 96 |
AY878651.1 | Hepatitis C virus subtype 6k isolate KM41, complete genome | 284 | ........................c.. | 310 | 96 |
AY878652.1 | Hepatitis C virus subtype 6n isolate KM42, complete genome | 283 | ........................a.. | 309 | 96 |
DQ071885.1 | Hepatitis C virus subtype 1b polyprotein mRNA, complete cds | 316 | ........................c.. | 342 | 96 |
DQ071885.1 | Hepatitis C virus subtype 1b polyprotein mRNA, complete cds | 3246 | ...ca...........g..________ | 3228 | 59 |
DQ278891.1 | Hepatitis C virus subtype 6k isolate KM45, complete genome | 315 | ........................c.. | 341 | 96 |
DQ278893.1 | Hepatitis C virus subtype 6k isolate KM41, complete genome | 316 | ........................c.. | 342 | 96 |
DQ278894.1 | Hepatitis C virus subtype 6n isolate KM42, complete genome | 317 | ........................a.. | 343 | 96 |
AJ851228.1 | Hepatitis C virus gene for polyprotein, genomic RNA, isolate Equatori | 289 | ........................c.. | 315 | 96 |
DQ418782.1 | Hepatitis C virus subtype 4a isolate 01-09 polyprotein gene, complete | 229 | ........................c.. | 255 | 96 |
DQ418783.1 | Hepatitis C virus subtype 4a isolate 02-42 polyprotein gene, complete | 194 | ........................c.. | 220 | 96 |
DQ418784.1 | Hepatitis C virus subtype 4a isolate 02C polyprotein gene, complete c | 239 | ........................c.. | 265 | 96 |
DQ418785.1 | Hepatitis C virus isolate 02Q polyprotein gene, partial cds | 237 | ........................c.. | 263 | 96 |
DQ418786.1 | Hepatitis C virus subtype 4d isolate 03-18 polyprotein gene, complete | 209 | ........................c.. | 235 | 96 |
DQ418787.1 | Hepatitis C virus subtype 4a isolate F753 polyprotein gene, complete | 237 | ........................c.. | 263 | 96 |
DQ418788.1 | Hepatitis C virus subtype 4a isolate F7157 polyprotein gene, complete | 237 | ........................c.. | 263 | 96 |
DQ418789.1 | Hepatitis C virus subtype 4a isolate L835 polyprotein gene, complete | 236 | ........................c.. | 262 | 96 |
DQ480524.1 | Hepatitis C virus subtype 6a strain 6a74, complete genome | 273 | ..................g........ | 299 | 96 |
DQ516083.1 | Hepatitis C virus subtype 4d isolate 24 polyprotein gene, complete cd | 254 | ........................c.. | 280 | 96 |
DQ516084.1 | Hepatitis C virus subtype 4a isolate 25 polyprotein gene, complete cd | 254 | ........................c.. | 280 | 96 |
DQ835763.1 | Hepatitis C virus subtype 6m isolate C-0208, complete genome | 313 | ........................c.. | 339 | 96 |
DQ835765.1 | Hepatitis C virus subtype 6m isolate C-0185, complete genome | 313 | ........................a.. | 339 | 96 |
DQ835767.1 | Hepatitis C virus subtype 6m isolate B4/92, complete genome | 313 | ........................c.. | 339 | 96 |
DQ835768.1 | Hepatitis C virus subtype 6n isolate D86/93, complete genome | 313 | ........................a.. | 339 | 96 |
DQ835768.1 | Hepatitis C virus subtype 6n isolate D86/93, complete genome | 3246 | .a.c.........c.ag....______ | 3226 | 59 |
DQ988073.1 | Hepatitis C virus isolate Eg2 polyprotein gene, partial cds | 234 | ........................c.. | 260 | 96 |
DQ988074.1 | Hepatitis C virus isolate Eg3 polyprotein gene, partial cds | 234 | ........................c.. | 260 | 96 |
DQ988074.1 | Hepatitis C virus isolate Eg3 polyprotein gene, partial cds | 1896 | ___..c...........__________ | 1883 | 48 |
DQ988075.1 | Hepatitis C virus isolate Eg4 polyprotein gene, partial cds | 234 | ........................c.. | 260 | 96 |
DQ988077.1 | Hepatitis C virus isolate Eg9 polyprotein gene, partial cds | 235 | ........................c.. | 261 | 96 |
DQ988078.1 | Hepatitis C virus isolate Eg10 polyprotein gene, partial cds | 230 | ........................c.. | 256 | 96 |
DQ988078.1 | Hepatitis C virus isolate Eg10 polyprotein gene, partial cds | 2688 | .........gg..gg....t.______ | 2708 | 59 |
EF032883.1 | Hepatitis C virus subtype 1a isolate 03-32_P1_10.16.03 polyprotein ge | 238 | ........................c.. | 264 | 96 |
EF032884.1 | Hepatitis C virus subtype 1a isolate 03-32_P2_5.14.04 polyprotein gen | 217 | ........................c.. | 243 | 96 |
EF032885.1 | Hepatitis C virus subtype 1a isolate 03-32_P4_11.5.05 polyprotein gen | 237 | ........................c.. | 263 | 96 |
EF032886.1 | Hepatitis C virus subtype 1a isolate BR601 polyprotein gene, complete | 243 | ........................c.. | 269 | 96 |
EF032887.1 | Hepatitis C virus subtype 1a isolate BR554_P1_5.23.03 polyprotein gen | 250 | ........................c.. | 276 | 96 |
EF032888.1 | Hepatitis C virus subtype 1a isolate BR554_P10_10.21.03 polyprotein g | 238 | ........................c.. | 264 | 96 |
EF032889.1 | Hepatitis C virus subtype 1a isolate BR554_P16_6.24.04 polyprotein ge | 222 | ........................c.. | 248 | 96 |
EF032890.1 | Hepatitis C virus subtype 1a isolate BR554_P17_10.21.04 polyprotein g | 236 | ........................c.. | 262 | 96 |
EF032892.1 | Hepatitis C virus subtype 1b isolate BR1427_P1_10.7.03 polyprotein ge | 292 | ........................c.. | 318 | 96 |
EF032893.1 | Hepatitis C virus subtype 1b isolate BR1427_P3_11.10.03 polyprotein g | 290 | ........................c.. | 316 | 96 |
EF032900.1 | Hepatitis C virus subtype 1a isolate BR111_P5_4.30.03 polyprotein gen | 236 | ........................c.. | 262 | 96 |
AB249644.1 | Hepatitis C virus subtype 1b genomic RNA, complete genome, hiroshima | 316 | ........................c.. | 342 | 96 |
AB249644.1 | Hepatitis C virus subtype 1b genomic RNA, complete genome, hiroshima | 3246 | ...ca...........g..________ | 3228 | 59 |
EF424625.1 | Hepatitis C virus subtype 6q isolate QC99, complete genome | 314 | ........................a.. | 340 | 96 |
EF424625.1 | Hepatitis C virus subtype 6q isolate QC99, complete genome | 3242 | _____..........ag....______ | 3227 | 51 |
EF424627.1 | Hepatitis C virus subtype 6o isolate QC227, complete genome | 313 | ........................a.. | 339 | 96 |
EF621489.1 | Hepatitis C virus subtype 1a strain HC-TN, complete genome | 316 | ........................c.. | 342 | 96 |
EF638081.1 | Hepatitis C virus subtype 1b from Hubei, complete genome | 272 | ........................c.. | 298 | 96 |
EF407411.1 | Hepatitis C virus isolate 5043 polyprotein gene, complete cds | 222 | ........................c.. | 248 | 96 |
EF407413.1 | Hepatitis C virus isolate 5012 polyprotein gene, complete cds | 263 | ........................c.. | 289 | 96 |
EF407414.1 | Hepatitis C virus isolate 7018 polyprotein gene, complete cds | 219 | ........................c.. | 245 | 96 |
EF407415.1 | Hepatitis C virus isolate 3018 polyprotein gene, complete cds | 266 | ........................c.. | 292 | 96 |
EF407417.1 | Hepatitis C virus isolate 4040 polyprotein gene, complete cds | 275 | ........................c.. | 301 | 96 |
EF407417.1 | Hepatitis C virus isolate 4040 polyprotein gene, complete cds | 7096 | _...........cgt.c...c.g.___ | 7118 | 62 |
EF407418.1 | Hepatitis C virus isolate 7020 polyprotein gene, complete cds | 260 | ........................c.. | 286 | 96 |
EF407419.1 | Hepatitis C virus isolate 5003 polyprotein gene, complete cds | 267 | ........................c.. | 293 | 96 |
EF407421.1 | Hepatitis C virus isolate 8030 polyprotein gene, complete cds | 219 | ........................c.. | 245 | 96 |
EF407422.1 | Hepatitis C virus isolate 6001 polyprotein gene, complete cds | 222 | ........................c.. | 248 | 96 |
EF407423.1 | Hepatitis C virus isolate 8028 polyprotein gene, complete cds | 262 | ........................c.. | 288 | 96 |
EF407424.1 | Hepatitis C virus isolate 5069 polyprotein gene, partial cds | 240 | ........................c.. | 266 | 96 |
EF407425.1 | Hepatitis C virus isolate 6071 polyprotein gene, complete cds | 230 | ........................c.. | 256 | 96 |
EF407426.1 | Hepatitis C virus isolate 8070 polyprotein genomic sequence | 265 | ........................c.. | 291 | 96 |
EF407427.1 | Hepatitis C virus isolate 6025 polyprotein gene, complete cds | 263 | ........................c.. | 289 | 96 |
EF407428.1 | Hepatitis C virus isolate 1024 polyprotein gene, complete cds | 222 | ........................c.. | 248 | 96 |
EF407431.1 | Hepatitis C virus isolate 3005 polyprotein gene, complete cds | 214 | ........................c.. | 240 | 96 |
EF407431.1 | Hepatitis C virus isolate 3005 polyprotein gene, complete cds | 7032 | _...........cgt.c...c.g.___ | 7054 | 62 |
EF407432.1 | Hepatitis C virus isolate 1013 polyprotein gene, complete cds | 277 | ........................c.. | 303 | 96 |
EF407433.1 | Hepatitis C virus isolate 7046 polyprotein gene, complete cds | 267 | ........................c.. | 293 | 96 |
EF407434.1 | Hepatitis C virus isolate 2011 polyprotein gene, complete cds | 238 | ........................c.. | 264 | 96 |
EF407435.1 | Hepatitis C virus isolate 5014 polyprotein gene, complete cds | 233 | ........................c.. | 259 | 96 |
EF407436.1 | Hepatitis C virus isolate 7040 polyprotein gene, complete cds | 221 | ........................c.. | 247 | 96 |
EF407436.1 | Hepatitis C virus isolate 7040 polyprotein gene, complete cds | 7042 | _...........cgt.c...c.g.___ | 7064 | 62 |
EF407437.1 | Hepatitis C virus isolate 1030 polyprotein gene, complete cds | 276 | ........................c.. | 302 | 96 |
EF407438.1 | Hepatitis C virus isolate 7012 polyprotein gene, complete cds | 263 | ........................c.. | 289 | 96 |
EF407439.1 | Hepatitis C virus isolate 8003 polyprotein gene, complete cds | 261 | ........................c.. | 287 | 96 |
EF407440.1 | Hepatitis C virus isolate 7002 polyprotein gene, complete cds | 264 | ........................c.. | 290 | 96 |
EF407441.1 | Hepatitis C virus isolate 1036 polyprotein gene, complete cds | 275 | ........................c.. | 301 | 96 |
EF407442.1 | Hepatitis C virus isolate 8012 polyprotein gene, complete cds | 230 | ........................c.. | 256 | 96 |
EF407443.1 | Hepatitis C virus isolate 7024 polyprotein gene, complete cds | 276 | ........................c.. | 302 | 96 |
EF407443.1 | Hepatitis C virus isolate 7024 polyprotein gene, complete cds | 2595 | ______________............_ | 2584 | 44 |
EF407444.1 | Hepatitis C virus isolate 6030 polyprotein gene, complete cds | 237 | ........................c.. | 263 | 96 |
EF407444.1 | Hepatitis C virus isolate 6030 polyprotein gene, complete cds | 3162 | _____.............t..______ | 3147 | 55 |
EF407445.1 | Hepatitis C virus isolate 5009 polyprotein gene, complete cds | 237 | ........................c.. | 263 | 96 |
EF407446.1 | Hepatitis C virus isolate 8009 polyprotein gene, complete cds | 237 | ........................c.. | 263 | 96 |
EF407447.1 | Hepatitis C virus isolate 8004 polyprotein gene, complete cds | 276 | ........................c.. | 302 | 96 |
EF407448.1 | Hepatitis C virus isolate 6018 polyprotein gene, partial cds | 276 | ........................c.. | 302 | 96 |
EF407449.1 | Hepatitis C virus isolate 2027 polyprotein gene, complete cds | 276 | ........................c.. | 302 | 96 |
EF407450.1 | Hepatitis C virus isolate 6020 polyprotein gene, complete cds | 234 | ........................c.. | 260 | 96 |
EF407451.1 | Hepatitis C virus isolate 7041 polyprotein gene, complete cds | 239 | ........................c.. | 265 | 96 |
EF407452.1 | Hepatitis C virus isolate 2005 polyprotein gene, complete cds | 247 | ........................c.. | 273 | 96 |
EF407453.1 | Hepatitis C virus isolate 4035 polyprotein gene, complete cds | 263 | ........................c.. | 289 | 96 |
EF407454.1 | Hepatitis C virus isolate 6031 polyprotein gene, complete cds | 228 | ........................c.. | 254 | 96 |
EF407455.1 | Hepatitis C virus isolate 7065 polyprotein gene, complete cds | 276 | ........................c.. | 302 | 96 |
EF407456.1 | Hepatitis C virus isolate 4025 polyprotein gene, complete cds | 275 | ........................c.. | 301 | 96 |
EF407457.1 | Hepatitis C virus isolate 1003 polyprotein gene, complete cds | 120 | ........................c.. | 146 | 96 |
EF407460.1 | Hepatitis C virus isolate 8007 polyprotein gene, complete cds | 266 | ........................c.. | 292 | 96 |
EF407461.1 | Hepatitis C virus isolate 5004 polyprotein gene, complete cds | 296 | ........................c.. | 322 | 96 |
EF407465.1 | Hepatitis C virus isolate 6017 polyprotein gene, complete cds | 261 | ........................c.. | 287 | 96 |
EF407465.1 | Hepatitis C virus isolate 6017 polyprotein gene, complete cds | 3191 | ...ca...........g..________ | 3173 | 59 |
EF407469.1 | Hepatitis C virus isolate 4014 polyprotein gene, complete cds | 260 | ........................c.. | 286 | 96 |
EF407469.1 | Hepatitis C virus isolate 4014 polyprotein gene, complete cds | 3190 | ...ca...........g..________ | 3172 | 59 |
EF407471.1 | Hepatitis C virus isolate 5044 polyprotein gene, complete cds | 261 | ........................c.. | 287 | 96 |
EF407472.1 | Hepatitis C virus isolate 4034 polyprotein gene, complete cds | 262 | ........................c.. | 288 | 96 |
EF407475.1 | Hepatitis C virus isolate 3009 polyprotein gene, complete cds | 248 | ........................c.. | 274 | 96 |
EF407475.1 | Hepatitis C virus isolate 3009 polyprotein gene, complete cds | 3173 | _____...........g..________ | 3160 | 48 |
EF407476.1 | Hepatitis C virus isolate 3012 polyprotein gene, complete cds | 248 | ........................c.. | 274 | 96 |
EF407479.1 | Hepatitis C virus isolate 4036 polyprotein gene, complete cds | 261 | ........................c.. | 287 | 96 |
EF407479.1 | Hepatitis C virus isolate 4036 polyprotein gene, complete cds | 3192 | _____...........g..________ | 3179 | 48 |
EF407480.1 | Hepatitis C virus isolate 3043 polyprotein gene, complete cds | 263 | ........................c.. | 289 | 96 |
EF407480.1 | Hepatitis C virus isolate 3043 polyprotein gene, complete cds | 3193 | ...ca...........g..________ | 3175 | 59 |
EF407482.1 | Hepatitis C virus isolate 6053 polyprotein gene, complete cds | 201 | ........................c.. | 227 | 96 |
EF407483.1 | Hepatitis C virus isolate 4043 polyprotein gene, complete cds | 291 | ........................c.. | 317 | 96 |
EF407485.1 | Hepatitis C virus isolate 7026 polyprotein gene, complete cds | 271 | ........................c.. | 297 | 96 |
EF407487.1 | Hepatitis C virus isolate 6057 polyprotein gene, complete cds | 263 | ........................c.. | 289 | 96 |
EF407488.1 | Hepatitis C virus isolate 8016 polyprotein gene, complete cds | 260 | ........................c.. | 286 | 96 |
EF407492.1 | Hepatitis C virus isolate 7025 polyprotein gene, complete cds | 256 | ........................c.. | 282 | 96 |
EF407492.1 | Hepatitis C virus isolate 7025 polyprotein gene, complete cds | 3186 | ...ca...........g..________ | 3168 | 59 |
EF407497.1 | Hepatitis C virus isolate 5002 polyprotein gene, complete cds | 260 | ........................c.. | 286 | 96 |
EF407501.1 | Hepatitis C virus isolate 7055 polyprotein gene, complete cds | 289 | ........................c.. | 315 | 96 |
EF407502.1 | Hepatitis C virus isolate 2038 polyprotein gene, complete cds | 345 | ........................c.. | 371 | 96 |
EF407502.1 | Hepatitis C virus isolate 2038 polyprotein gene, complete cds | 3275 | ...c............g..c.______ | 3255 | 66 |
EF407503.1 | Hepatitis C virus isolate 5083 polyprotein gene, complete cds | 263 | ........................c.. | 289 | 96 |
EF407503.1 | Hepatitis C virus isolate 5083 polyprotein gene, complete cds | 3193 | ...ca...........g..________ | 3175 | 59 |
EF407504.1 | Hepatitis C virus isolate 8069 polyprotein gene, complete cds | 270 | ........................c.. | 296 | 96 |
EF407504.1 | Hepatitis C virus isolate 8069 polyprotein gene, complete cds | 3199 | _..c............g..________ | 3182 | 59 |
EF589160.1 | Hepatitis C virus subtype 4f strain IFBT84 polyprotein gene, partial | 250 | ........................c.. | 276 | 96 |
EF589161.1 | Hepatitis C virus subtype 4f strain IFBT88 polyprotein gene, partial | 249 | ........................c.. | 275 | 96 |
EU155241.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V71/2002, complete | 212 | ........................c.. | 238 | 96 |
EU155294.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V329/2002, complet | 210 | ........................c.. | 236 | 96 |
EU155294.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V329/2002, complet | 7031 | _...........cgt.c...c.g.___ | 7053 | 62 |
EU155345.1 | Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V221/2002, complet | 224 | ........................c.. | 250 | 96 |
EU155350.1 | Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V256/2003, complet | 197 | ........................c.. | 223 | 96 |
EU155350.1 | Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V256/2003, complet | 7018 | _...........cgc....._______ | 7036 | 59 |
EU155379.1 | Hepatitis C virus subtype 1a isolate HCV-1a/DE/BID-V29/2003, complete | 212 | ........................c.. | 238 | 96 |
EU260395.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V10/2005, complete | 249 | ........................c.. | 275 | 96 |
EU362876.1 | Hepatitis C virus isolate 1013_FU24 polyprotein (pol) gene, complete | 275 | ........................c.. | 301 | 96 |
EU362877.1 | Hepatitis C virus isolate 1024_FU24 polyprotein (pol) gene, complete | 221 | ........................c.. | 247 | 96 |
EU362878.1 | Hepatitis C virus isolate 1030_FU24 polyprotein (pol) gene, partial c | 276 | ........................c.. | 302 | 96 |
EU362879.1 | Hepatitis C virus isolate 2005_FU24 polyprotein (pol) gene, partial c | 275 | ........................c.. | 301 | 96 |
EU362880.1 | Hepatitis C virus isolate 2011_FU24 polyprotein (pol) gene, partial c | 237 | ........................c.. | 263 | 96 |
EU362881.1 | Hepatitis C virus isolate 2027_FU24 polyprotein (pol) gene, partial c | 277 | ........................c.. | 303 | 96 |
EU362882.1 | Hepatitis C virus isolate 3005_FU24 polyprotein (pol) gene, complete | 235 | ........................c.. | 261 | 96 |
EU362883.1 | Hepatitis C virus isolate 4025_FU24 polyprotein (pol) gene, partial c | 275 | ........................c.. | 301 | 96 |
EU362884.1 | Hepatitis C virus isolate 4035_FU24 polyprotein (pol) gene, complete | 278 | ........................c.. | 304 | 96 |
EU362885.1 | Hepatitis C virus isolate 5009_FU24 polyprotein (pol) gene, partial c | 234 | ........................c.. | 260 | 96 |
EU362886.1 | Hepatitis C virus isolate 5014_FU24 polyprotein (pol) gene, complete | 238 | ........................c.. | 264 | 96 |
EU362887.1 | Hepatitis C virus isolate 6020_FU24 polyprotein (pol) gene, complete | 234 | ........................c.. | 260 | 96 |
EU362890.1 | Hepatitis C virus isolate 7002_FU24 polyprotein (pol) gene, partial c | 275 | ........................c.. | 301 | 96 |
EU362891.1 | Hepatitis C virus isolate 7003_FU24 polyprotein (pol) gene, partial c | 238 | ........................c.. | 264 | 96 |
EU362892.1 | Hepatitis C virus isolate 7012_FU24 polyprotein (pol) gene, complete | 261 | ........................c.. | 287 | 96 |
EU362893.1 | Hepatitis C virus isolate 7040_FU24 polyprotein (pol) gene, complete | 224 | ........................c.. | 250 | 96 |
EU362893.1 | Hepatitis C virus isolate 7040_FU24 polyprotein (pol) gene, complete | 7045 | _...........cgt.c...c.g.___ | 7067 | 62 |
EU362894.1 | Hepatitis C virus isolate 7041_FU24 polyprotein (pol) gene, partial c | 213 | ........................c.. | 239 | 96 |
EU362895.1 | Hepatitis C virus isolate 7043_FU24 polyprotein (pol) gene, complete | 234 | ........................c.. | 260 | 96 |
EU362896.1 | Hepatitis C virus isolate 7046_FU24 polyprotein (pol) gene, complete | 275 | ........................c.. | 301 | 96 |
EU362897.1 | Hepatitis C virus isolate 7065_FU24 polyprotein (pol) gene, complete | 275 | ........................c.. | 301 | 96 |
EU362898.1 | Hepatitis C virus isolate 8012_FU24 polyprotein (pol) gene, complete | 220 | ........................c.. | 246 | 96 |
EU362899.1 | Hepatitis C virus isolate 1013q polyprotein (pol) gene, partial cds | 277 | ........................c.. | 303 | 96 |
EU362900.1 | Hepatitis C virus isolate 1030q polyprotein (pol) gene, partial cds | 276 | ........................c.. | 302 | 96 |
EU362901.1 | Hepatitis C virus isolate 2011q polyprotein (pol) gene, complete cds | 238 | ........................c.. | 264 | 96 |
EU362902.1 | Hepatitis C virus isolate 2027q polyprotein (pol) gene, partial cds | 276 | ........................c.. | 302 | 96 |
EU362903.1 | Hepatitis C virus isolate 4025q polyprotein (pol) gene, partial cds | 275 | ........................c.. | 301 | 96 |
EU362907.1 | Hepatitis C virus isolate 7002q polyprotein (pol) gene, complete cds | 264 | ........................c.. | 290 | 96 |
EU363761.1 | Recombinant Hepatitis C virus H77C/JFH1, complete genome | 315 | ........................c.. | 341 | 96 |
EU239713.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V316/2001, complet | 264 | ........................c.. | 290 | 96 |
EU239714.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V417/2001, complet | 265 | ........................c.. | 291 | 96 |
EU239714.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V417/2001, complet | 3195 | ...ca...........g..________ | 3177 | 59 |
EU239715.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V423/2003, complet | 242 | ........................c.. | 268 | 96 |
EU239716.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V431/2002, complet | 233 | ........................c.. | 259 | 96 |
EU250017.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V508/2001, complet | 233 | ........................c.. | 259 | 96 |
EU260396.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V11/2004, complete | 219 | ........................c.. | 245 | 96 |
EU234061.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V126/1991, complet | 264 | ........................c.. | 290 | 96 |
EU234062.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V135/1992, complet | 264 | ........................c.. | 290 | 96 |
EU234062.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V135/1992, complet | 3194 | .t.c............g..________ | 3176 | 59 |
EU234063.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V177/1992, complet | 237 | ........................c.. | 263 | 96 |
EU234064.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V182/1990, complet | 230 | ........................a.. | 256 | 96 |
EU234064.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V182/1990, complet | 7050 | ............cgt.c...c.g.___ | 7073 | 66 |
EU155213.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V101/2004, complet | 245 | ........................c.. | 271 | 96 |
EU155213.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V101/2004, complet | 7066 | _...........cgt.c...c.g.___ | 7088 | 62 |
EU155213.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V101/2004, complet | 2564 | ______________............_ | 2553 | 44 |
EU155214.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V104/2005, complet | 242 | ........................c.. | 268 | 96 |
EU155215.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V105/2004, complet | 211 | ........................c.. | 237 | 96 |
EU155216.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V115/2001, complet | 236 | ........................c.. | 262 | 96 |
EU155217.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V142/2004, complet | 264 | ........................c.. | 290 | 96 |
EU155217.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V142/2004, complet | 3189 | _____...........g..________ | 3176 | 48 |
EU155218.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V145/2005, complet | 265 | ........................c.. | 291 | 96 |
EU155219.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V146/2002, complet | 264 | ........................c.. | 290 | 96 |
EU155219.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V146/2002, complet | 3194 | ...ca...........g..________ | 3176 | 59 |
EU155220.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V147/2004, complet | 250 | ........................c.. | 276 | 96 |
EU155221.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V148/2004, complet | 264 | ........................c.. | 290 | 96 |
EU155221.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V148/2004, complet | 3194 | ...ca...........g..________ | 3176 | 59 |
EU155222.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V150/2004, complet | 264 | ........................c.. | 290 | 96 |
EU155223.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V151/2002, complet | 264 | ........................c.. | 290 | 96 |
EU155223.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V151/2002, complet | 3200 | ...ca...........g..________ | 3182 | 59 |
EU155224.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V152/2003, complet | 264 | ........................c.. | 290 | 96 |
EU155224.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V152/2003, complet | 3194 | ...ca...........g..c.______ | 3174 | 62 |
EU155225.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V155/2003, complet | 265 | ........................c.. | 291 | 96 |
EU155226.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V156/2004, complet | 264 | ........................c.. | 290 | 96 |
EU155226.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V156/2004, complet | 3194 | ...ca...........g..________ | 3176 | 59 |
EU155227.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V157/2003, complet | 264 | ........................c.. | 290 | 96 |
EU155228.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V158/2003, complet | 264 | ........................c.. | 290 | 96 |
EU155228.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V158/2003, complet | 3194 | ...ca...........g..________ | 3176 | 59 |
EU155229.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V159/2004, complet | 264 | ........................c.. | 290 | 96 |
EU155229.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V159/2004, complet | 3194 | ...c............g..________ | 3176 | 62 |
EU155230.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V160/2002, complet | 264 | ........................c.. | 290 | 96 |
EU155231.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V163/2002, complet | 264 | ........................c.. | 290 | 96 |
EU155231.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V163/2002, complet | 3194 | ...ca...........g..________ | 3176 | 59 |
EU155232.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V164/2002, complet | 265 | ........................c.. | 291 | 96 |
EU155233.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V445/2006, complet | 243 | ........................c.. | 269 | 96 |
EU155234.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V447/2006, complet | 265 | ........................c.. | 291 | 96 |
EU155234.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V447/2006, complet | 3195 | ...ca...........g..t.______ | 3175 | 62 |
EU155235.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V449/2006, complet | 264 | ........................c.. | 290 | 96 |
EU155236.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V450/2006, complet | 207 | ........................c.. | 233 | 96 |
EU155237.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V457/2006, complet | 257 | ........................c.. | 283 | 96 |
EU155238.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V465/2007, complet | 242 | ........................c.. | 268 | 96 |
EU155239.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V54/2004, complete | 234 | ........................c.. | 260 | 96 |
EU155240.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V68/2004, complete | 234 | ........................c.. | 260 | 96 |
EU155242.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V73/2004, complete | 233 | ........................c.. | 259 | 96 |
EU155242.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V73/2004, complete | 3158 | _____...........g.t..______ | 3143 | 51 |
EU155243.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V86/2005, complete | 211 | ........................c.. | 237 | 96 |
EU155244.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V90/2005, complete | 257 | ........................c.. | 283 | 96 |
EU155245.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V91/2003, complete | 234 | ........................c.. | 260 | 96 |
EU155246.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V93/2003, complete | 235 | ........................c.. | 261 | 96 |
EU482831.1 | Hepatitis C virus subtype 1a isolate HCV-1a/DE/BID-V25/2003, complete | 222 | ........................c.. | 248 | 96 |
EU482832.1 | Hepatitis C virus subtype 1a isolate HCV-1a/DE/BID-V33/2004, complete | 226 | ........................c.. | 252 | 96 |
EU482833.1 | Hepatitis C virus subtype 1b isolate HCV-1b/DE/BID-V503/2003, complet | 264 | ........................c.. | 290 | 96 |
EU482833.1 | Hepatitis C virus subtype 1b isolate HCV-1b/DE/BID-V503/2003, complet | 3194 | ...ca...........g..________ | 3176 | 59 |
EU482834.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V422/2002, complet | 198 | ........................c.. | 224 | 96 |
EU482835.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V427/2002, complet | 249 | ........................c.. | 275 | 96 |
EU482836.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V506/2002, complet | 247 | ........................c.. | 273 | 96 |
EU482837.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V17/2004, complete | 233 | ........................c.. | 259 | 96 |
EU482838.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V361/2006, complet | 248 | ........................c.. | 274 | 96 |
EU482839.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V370/2006, complet | 264 | ........................c.. | 290 | 96 |
EU482840.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V386/2004, complet | 254 | ........................c.. | 280 | 96 |
EU482840.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V386/2004, complet | 3179 | _____...........g....______ | 3164 | 55 |
EU482841.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V387/2004, complet | 249 | ........................c.. | 275 | 96 |
EU482842.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V389/2006, complet | 221 | ........................c.. | 247 | 96 |
EU482842.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V389/2006, complet | 3146 | _____...........g....______ | 3131 | 55 |
EU482843.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V435/2005, complet | 243 | ........................c.. | 269 | 96 |
EU482844.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V436/2006, complet | 250 | ........................c.. | 276 | 96 |
EU482845.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V438/2006, complet | 249 | ........................c.. | 275 | 96 |
EU482846.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V439/2000, complet | 243 | ........................c.. | 269 | 96 |
EU482847.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V5/2004, complete | 233 | ........................c.. | 259 | 96 |
EU482848.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V9/2005, complete | 218 | ........................c.. | 244 | 96 |
EU482849.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V138/1989, complet | 264 | ........................c.. | 290 | 96 |
EU482849.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V138/1989, complet | 3194 | .t.c............g..________ | 3176 | 59 |
EU482850.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V186/1990, complet | 211 | ........................c.. | 237 | 96 |
EU482852.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V217/1989, complet | 233 | ........................c.. | 259 | 96 |
EU482853.1 | Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V227/2005, complet | 235 | ........................c.. | 261 | 96 |
EU482854.1 | Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V242/2001, complet | 233 | ........................c.. | 259 | 96 |
EU482854.1 | Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V242/2001, complet | 3158 | _____...........g....______ | 3143 | 55 |
EU482854.1 | Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V242/2001, complet | 7054 | _...........cgt.c...c.g.___ | 7076 | 62 |
EU482855.1 | Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V249/2002, complet | 227 | ........................c.. | 253 | 96 |
EU482856.1 | Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V250/2002, complet | 234 | ........................c.. | 260 | 96 |
EU482857.1 | Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V263/2005, complet | 233 | ........................c.. | 259 | 96 |
EU482858.1 | Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V271/2006, complet | 240 | ........................c.. | 266 | 96 |
EU482859.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V272/2003, complet | 264 | ........................c.. | 290 | 96 |
EU482860.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V302/2003, complet | 264 | ........................c.. | 290 | 96 |
EU482861.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V446/2006, complet | 242 | ........................c.. | 268 | 96 |
EU482862.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V454/2006, complet | 242 | ........................c.. | 268 | 96 |
EU482863.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V456/2006, complet | 246 | ........................c.. | 272 | 96 |
EU482864.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V459/2006, complet | 249 | ........................c.. | 275 | 96 |
EU482865.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V46/2003, complete | 222 | ........................c.. | 248 | 96 |
EU482866.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V460/2006, complet | 249 | ........................c.. | 275 | 96 |
EU482867.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V461/2006, complet | 249 | ........................c.. | 275 | 96 |
EU482867.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V461/2006, complet | 3174 | _____...........g....______ | 3159 | 55 |
EU482868.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V69/2002, complete | 233 | ........................c.. | 259 | 96 |
EU482869.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V70/2002, complete | 233 | ........................c.. | 259 | 96 |
EU482870.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V75/2004, complete | 257 | ........................c.. | 283 | 96 |
EU482871.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V77/2002, complete | 225 | ........................c.. | 251 | 96 |
EU482872.1 | Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V261/2004, complet | 242 | ........................c.. | 268 | 96 |
EU482873.1 | Hepatitis C virus subtype 1a isolate HCV-1a/DE/BID-V28/2003, complete | 227 | ........................c.. | 253 | 96 |
EU482874.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V287/2005, complet | 264 | ........................c.. | 290 | 96 |
EU482875.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V310/2005, complet | 264 | ........................c.. | 290 | 96 |
EU482876.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V330/2002, complet | 242 | ........................c.. | 268 | 96 |
EU482877.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V342/2001, complet | 264 | ........................c.. | 290 | 96 |
EU482877.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V342/2001, complet | 3200 | ...ca...........g..________ | 3182 | 59 |
EU482878.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V19/2004, complete | 242 | ........................c.. | 268 | 96 |
EU482879.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V372/2006, complet | 264 | ........................c.. | 290 | 96 |
EU482880.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V373/2006, complet | 264 | ........................c.. | 290 | 96 |
EU482880.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V373/2006, complet | 3197 | ...c............g..________ | 3179 | 62 |
EU482881.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V383/2003, complet | 264 | ........................c.. | 290 | 96 |
EU482882.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V410/2006, complet | 226 | ........................a.. | 252 | 96 |
EU482883.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V153/2005, complet | 264 | ........................c.. | 290 | 96 |
EU482883.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V153/2005, complet | 3200 | ...c............g..________ | 3182 | 62 |
EU482885.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V448/2006, complet | 264 | ........................c.. | 290 | 96 |
EU482885.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V448/2006, complet | 3197 | ...ca...........g..________ | 3179 | 59 |
EU482886.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V458/2006, complet | 265 | ........................c.. | 291 | 96 |
EU482887.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V66/2002, complete | 211 | ........................c.. | 237 | 96 |
EU482888.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V123/1992, complet | 264 | ........................c.. | 290 | 96 |
EU482889.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V179/1990, complet | 243 | ........................c.. | 269 | 96 |
EU155247.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V1/2005, complete | 240 | ........................c.. | 266 | 96 |
EU155248.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V336/2006, complet | 234 | ........................c.. | 260 | 96 |
EU155249.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V337/2006, complet | 233 | ........................c.. | 259 | 96 |
EU155250.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V358/2006, complet | 241 | ........................c.. | 267 | 96 |
EU155251.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V359/2006, complet | 227 | ........................c.. | 253 | 96 |
EU155252.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V362/2006, complet | 233 | ........................c.. | 259 | 96 |
EU155252.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V362/2006, complet | 2634 | ..c.t..a.ag............____ | 2612 | 66 |
EU155253.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V363/2006, complet | 264 | ........................c.. | 290 | 96 |
EU155254.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V365/2006, complet | 265 | ........................c.. | 291 | 96 |
EU155255.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V366/2006, complet | 264 | ........................c.. | 290 | 96 |
EU155255.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V366/2006, complet | 3200 | ...c.........c..g..________ | 3182 | 59 |
EU155256.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V367/2006, complet | 264 | ........................c.. | 290 | 96 |
EU155257.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V369/2006, complet | 264 | ........................c.. | 290 | 96 |
EU155258.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V371/2006, complet | 264 | ........................c.. | 290 | 96 |
EU155258.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V371/2006, complet | 3194 | ...ca...........g..________ | 3176 | 59 |
EU155259.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V374/2006, complet | 264 | ........................c.. | 290 | 96 |
EU155259.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V374/2006, complet | 3194 | ...ca...........g..________ | 3176 | 59 |
EU155260.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V375/2006, complet | 264 | ........................c.. | 290 | 96 |
EU155261.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V379/2005, complet | 265 | ........................c.. | 291 | 96 |
EU155262.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V381/2001, complet | 264 | ........................c.. | 290 | 96 |
EU155262.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V381/2001, complet | 3194 | ...ca...........g..________ | 3176 | 59 |
EU155263.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V384/2005, complet | 264 | ........................c.. | 290 | 96 |
EU155263.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V384/2005, complet | 3189 | _____...........g..________ | 3176 | 48 |
EU155264.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V385/2006, complet | 242 | ........................c.. | 268 | 96 |
EU155265.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V388/2005, complet | 236 | ........................c.. | 262 | 96 |
EU155265.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V388/2005, complet | 7057 | _...........cgt.c...c.g.___ | 7079 | 62 |
EU155266.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V390/2006, complet | 185 | ........................c.. | 211 | 96 |
EU155267.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V391/2006, complet | 222 | ........................c.. | 248 | 96 |
EU155268.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V396/2006, complet | 211 | ........................c.. | 237 | 96 |
EU155269.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V398/2006, complet | 235 | ........................c.. | 261 | 96 |
EU155270.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V399/2006, complet | 233 | ........................c.. | 259 | 96 |
EU155271.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V401/2006, complet | 238 | ........................c.. | 264 | 96 |
EU155272.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V404/2006, complet | 212 | ........................c.. | 238 | 96 |
EU155273.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V406/2006, complet | 185 | ........................c.. | 211 | 96 |
EU155274.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V407/2006, complet | 187 | ........................c.. | 213 | 96 |
EU155275.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V409/2006, complet | 236 | ........................a.. | 262 | 96 |
EU155276.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V432/2002, complet | 235 | ........................c.. | 261 | 96 |
EU155277.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V434/2003, complet | 211 | ........................c.. | 237 | 96 |
EU155278.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V437/2006, complet | 226 | ........................c.. | 252 | 96 |
EU155279.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V441/2001, complet | 264 | ........................c.. | 290 | 96 |
EU155280.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V442/2001, complet | 264 | ........................c.. | 290 | 96 |
EU155280.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V442/2001, complet | 3194 | ...ca...........g..________ | 3176 | 59 |
EU155281.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V512/2005, complet | 264 | ........................c.. | 290 | 96 |
EU155282.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V696/2006, complet | 233 | ........................c.. | 259 | 96 |
EU155283.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V698/2006, complet | 249 | ........................c.. | 275 | 96 |
EU155283.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V698/2006, complet | 3174 | _____...........g....______ | 3159 | 55 |
EU155285.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V318/2001, complet | 224 | ........................c.. | 250 | 96 |
EU155286.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V319/2001, complet | 211 | ........................c.. | 237 | 96 |
EU155288.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V322/2002, complet | 233 | ........................c.. | 259 | 96 |
EU155289.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V323/2001, complet | 242 | ........................c.. | 268 | 96 |
EU155289.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V323/2001, complet | 7063 | _...........cgt.c...c.g.___ | 7085 | 62 |
EU155290.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V325/2001, complet | 221 | ........................c.. | 247 | 96 |
EU155291.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V326/2002, complet | 235 | ........................c.. | 261 | 96 |
EU155292.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V327/2001, complet | 243 | ........................c.. | 269 | 96 |
EU155293.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V328/2001, complet | 186 | ........................c.. | 212 | 96 |
EU155295.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V331/2002, complet | 235 | ........................c.. | 261 | 96 |
EU155295.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V331/2002, complet | 7056 | _...........cgt.c...c.g.___ | 7078 | 62 |
EU155296.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V332/2002, complet | 232 | ........................c.. | 258 | 96 |
EU155297.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V333/2002, complet | 232 | ........................c.. | 258 | 96 |
EU155298.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V334/2002, complet | 246 | ........................c.. | 272 | 96 |
EU155299.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V335/2003, complet | 232 | ........................c.. | 258 | 96 |
EU155300.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V341/2003, complet | 263 | ........................c.. | 289 | 96 |
EU155300.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V341/2003, complet | 3193 | ...ca...........g..________ | 3175 | 59 |
EU155301.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V344/2001, complet | 264 | ........................c.. | 290 | 96 |
EU155302.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V345/2001, complet | 264 | ........................c.. | 290 | 96 |
EU155302.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V345/2001, complet | 3194 | ...ca...........g..________ | 3176 | 59 |
EU155303.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V346/2001, complet | 264 | ........................c.. | 290 | 96 |
EU155305.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V350/2002, complet | 264 | ........................c.. | 290 | 96 |
EU155306.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V352/2002, complet | 264 | ........................c.. | 290 | 96 |
EU155306.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V352/2002, complet | 3189 | _____...........g..________ | 3176 | 48 |
EU155307.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V353/2002, complet | 265 | ........................c.. | 291 | 96 |
EU155308.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V354/2003, complet | 264 | ........................c.. | 290 | 96 |
EU155308.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V354/2003, complet | 3194 | ...ca...........g..________ | 3176 | 59 |
EU155309.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V356/2003, complet | 231 | ........................c.. | 257 | 96 |
EU155310.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V357/2004, complet | 231 | ........................c.. | 257 | 96 |
EU155311.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V411/2003, complet | 242 | ........................c.. | 268 | 96 |
EU155312.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V412/2000, complet | 224 | ........................c.. | 250 | 96 |
EU155313.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V413/2003, complet | 224 | ........................c.. | 250 | 96 |
EU155314.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V414/2004, complet | 190 | ........................c.. | 216 | 96 |
EU155315.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V416/2001, complet | 264 | ........................c.. | 290 | 96 |
EU155315.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V416/2001, complet | 8567 | ...t..a.a........._________ | 8550 | 55 |
EU155316.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V419/2002, complet | 264 | ........................c.. | 290 | 96 |
EU155317.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V420/2002, complet | 264 | ........................c.. | 290 | 96 |
EU155317.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V420/2002, complet | 3194 | ...ca...........g..________ | 3176 | 59 |
EU155318.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V421/2005, complet | 264 | ........................c.. | 290 | 96 |
EU155318.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V421/2005, complet | 3194 | ...ct...........g..________ | 3176 | 59 |
EU155319.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V424/2002, complet | 194 | ........................c.. | 220 | 96 |
EU155319.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V424/2002, complet | 3119 | _____...........g....______ | 3104 | 55 |
EU155320.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V425/2001, complet | 187 | ........................c.. | 213 | 96 |
EU155321.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V426/2001, complet | 190 | ........................c.. | 216 | 96 |
EU155322.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V428/2001, complet | 230 | ........................c.. | 256 | 96 |
EU155323.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V429/2002, complet | 227 | ........................c.. | 253 | 96 |
EU155324.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V121/1992, complet | 264 | ........................c.. | 290 | 96 |
EU155324.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V121/1992, complet | 3194 | ...ca...........g..________ | 3176 | 59 |
EU155325.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V122/1991, complet | 264 | ........................c.. | 290 | 96 |
EU155325.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V122/1991, complet | 3194 | ...ca...........g..________ | 3176 | 59 |
EU155326.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V124/1992, complet | 264 | ........................c.. | 290 | 96 |
EU155326.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V124/1992, complet | 3194 | ...c............g..________ | 3176 | 62 |
EU155327.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V125/1992, complet | 257 | ........................c.. | 283 | 96 |
EU155327.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V125/1992, complet | 3184 | ...ca...........g..c.______ | 3164 | 62 |
EU155328.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V127/1992, complet | 264 | ........................c.. | 290 | 96 |
EU155328.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V127/1992, complet | 3194 | ...ca...........g..________ | 3176 | 59 |
EU155329.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V128/1992, complet | 264 | ........................c.. | 290 | 96 |
EU155329.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V128/1992, complet | 3194 | ...ca...........g..________ | 3176 | 59 |
EU155330.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V130/1994, complet | 286 | ........................c.. | 312 | 96 |
EU155330.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V130/1994, complet | 3216 | ...ca...........g..________ | 3198 | 59 |
EU155331.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V131/1990, complet | 264 | ........................c.. | 290 | 96 |
EU155331.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V131/1990, complet | 3189 | _____...........g..._______ | 3175 | 51 |
EU155332.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V132/1996, complet | 264 | ........................c.. | 290 | 96 |
EU155332.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V132/1996, complet | 3194 | ...ca...........g..________ | 3176 | 59 |
EU155333.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V133/1989, complet | 253 | ........................c.. | 279 | 96 |
EU155333.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V133/1989, complet | 3183 | ...ca...........g..________ | 3165 | 59 |
EU155334.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V134/1990, complet | 264 | ........................c.. | 290 | 96 |
EU155334.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V134/1990, complet | 3194 | ...ca...........g..________ | 3176 | 59 |
EU155335.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V136/1992, complet | 264 | ........................c.. | 290 | 96 |
EU155335.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V136/1992, complet | 3194 | ...c............g..c.______ | 3174 | 66 |
EU155336.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V139/1992, complet | 264 | ........................c.. | 290 | 96 |
EU155336.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V139/1992, complet | 3194 | ...ca...........g..________ | 3176 | 59 |
EU155337.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V141/1990, complet | 264 | ........................c.. | 290 | 96 |
EU155337.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V141/1990, complet | 3194 | ...c.........c..g..________ | 3176 | 59 |
EU155338.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V169/1996, complet | 234 | ........................c.. | 260 | 96 |
EU155339.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V172/1990, complet | 211 | ........................c.. | 237 | 96 |
EU155340.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V185/1991, complet | 211 | ........................c.. | 237 | 96 |
EU155341.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V192/1992, complet | 244 | ........................c.. | 270 | 96 |
EU155342.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V197/1989, complet | 211 | ........................c.. | 237 | 96 |
EU155343.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V214/1996, complet | 235 | ........................c.. | 261 | 96 |
EU155344.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V216/1990, complet | 222 | ........................c.. | 248 | 96 |
EU155346.2 | Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V236/2005, complet | 238 | ........................c.. | 264 | 96 |
EU155348.2 | Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V240/2005, complet | 225 | ........................c.. | 251 | 96 |
EU155349.2 | Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V246/2005, complet | 223 | ........................c.. | 249 | 96 |
EU155349.2 | Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V246/2005, complet | 7044 | _...........cgt.c...c.g.___ | 7066 | 62 |
EU155351.2 | Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V257/2003, complet | 237 | ........................c.. | 263 | 96 |
EU155352.2 | Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V262/2004, complet | 242 | ........................c.. | 268 | 96 |
EU155353.2 | Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V267/2005, complet | 234 | ........................c.. | 260 | 96 |
EU155354.2 | Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V269/2005, complet | 241 | ........................c.. | 267 | 96 |
EU155355.2 | Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V270/2006, complet | 240 | ........................c.. | 266 | 96 |
EU155356.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V273/2003, complet | 264 | ........................c.. | 290 | 96 |
EU155357.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V275/2003, complet | 264 | ........................c.. | 290 | 96 |
EU155358.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V276/2004, complet | 264 | ........................c.. | 290 | 96 |
EU155359.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V277/2002, complet | 265 | ........................c.. | 291 | 96 |
EU155360.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V278/2003, complet | 264 | ........................c.. | 290 | 96 |
EU155360.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V278/2003, complet | 3194 | ...ca...........g..c.______ | 3174 | 62 |
EU155361.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V281/2004, complet | 264 | ........................c.. | 290 | 96 |
EU155362.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V282/2004, complet | 264 | ........................c.. | 290 | 96 |
EU155363.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V285/2005, complet | 264 | ........................c.. | 290 | 96 |
EU155363.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V285/2005, complet | 3194 | ...ca...........g..________ | 3176 | 59 |
EU155364.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V288/2006, complet | 264 | ........................c.. | 290 | 96 |
EU155365.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V289/2006, complet | 264 | ........................c.. | 290 | 96 |
EU155365.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V289/2006, complet | 3194 | ...ca...........g..c.______ | 3174 | 62 |
EU155366.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V294/2002, complet | 264 | ........................c.. | 290 | 96 |
EU155367.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V295/2002, complet | 264 | ........................c.. | 290 | 96 |